Question: The Handbook says we should never go under anesthesia without the healthcare provider knowing of any potential risk of pheochromocytoma. What if you go to a dentist and he has to use local anaesthesia just to numb your mouth for cavity fillings? Should that be a concern for VHL patients?

Response: There are concerns about spinal anesthesia — your anesthesiologist should check and be aware if there are any spinal hemangiomas in the area where they will be inserting needles. Dr. Oldfield gave us a good answer for that one in June 2001. Obviously that is not a concern in the case of dentistry.

There are also concerns about having a pheo incident during anesthesia. A pheo episode can be provoked by lots of things, from a fall or a minor auto accident on up — any kind of stress-provoking incident. It would clearly be best for you to know before the dental procedure whether or not you have a pheo to worry about. You do this through regular check-ups. If you are on a regular check-up schedule and do not have an active pheo, then there should be nothing of concern for your dentist to worry about.

If you have a pheo of any size, even if it is considered "inactive," it would be wise to advise your dentist, just in case. Dental procedures can definitely set off a pheo. Any type of stimulus can set off a pheo. They are very unpredictable. You might say something like "low risk of pheochromocytoma". In the remote case of a crisis, it’s the clue that could save your life.

– Our thanks to Dr. Gladys M. Glenn & Dr. McClellan Walther of the U.S. National Institutes of Health for their help in preparing this reply. See Dr. Oldfield’s response in VHLFF June 2001, www.vhl.org/newsletter/vhl2001/01bnaske.php

Rearrangements and Deletions

Question: As I was getting our papers ready to take to NIH last night, I noticed that my husband’s DNA results read that he has a "rearrangement of the VHL gene" and that our 2 sons’ results read that they have "a partial deletion in the VHL gene." I am curious if that means that they have a different mutation than their Dad? I am embarrassed by my lack of understanding of the genetics of VHL. In our online discussion group one person expressed interest in finding "others with the same mutation 454 C to T (P81S)." I looked and can’t find that sort of info on any of their DNA results and wondered why. – Robin K., Texas

Response: First of all, please don’t be embarrassed. Genetic terminology can be very confusing, and sometimes two different names can be used to describe the same effect. For example, a "rearrangement of the VHL gene" often produces a "partial deletion of the VHL gene", so the mutation that your husband has is almost certainly the same mutation that was described for your sons. I’ll try to explain in more detail.

A rearrangement is a type of mutation that can affect relatively large portions of a gene, and typically the rearranged fragment will move to another part of the chromosome (or to another chromosome), and therefore loses its function. So the fragment that stays in place is now shorter – in genetic terms, the type of mutation that has arisen is called a ‘truncation’. The gene is now described as ‘truncated’.

Imagine this is the VHL gene:

TTAATGAATAGCTTGGCATTACCATCGGAACCA

If the gene breaks in the middle (and we don’t yet understand what can cause it to break)...

TTAATGAATAGCTTGGCATTAC CATCGGAACCA

... then what stays in place is now a truncated (therefore mutated) gene

TTAATGAATAGCTTGGCATTAC

This truncated gene does not work the same as the intact, full-length gene, and can give rise to VHL lesions.

Meanwhile, the other fragment CATCGGAACCA has moved to another chromosomal location. It has relocated or ‘rearranged’. In its new location, this fragment has lost its original function.

By contrast, point mutations, such as 454 (C to T) which you mention, are different types of mutations altogether. Here, there are no big breaks and relocations of the VHL gene, but instead, just one ‘letter’ of the gene is altered. In this type of mutation, the size of the gene remains the same.

The fifth letter is mutated in this hypothetical example. A geneticist would call this a 5 (T to G) mutation.

TTAATGAATAGCTTGGCATTACCATCGGAACCA

TTAAGGAATAGCTTGGCATTACCATCGGAACCA

In families with a 454 (C to T) mutation, the change in letters affects position 454, instead of position 5. A genetic test would not identify such point mutations in your husband or sons, because entire strings of letters are missing.

It may seem surprising that large deletions of the gene and very small point mutations can have similar clinical consequences (that is, they both cause VHL tumors to develop). However, keep in mind that this is not exactly true: families who have large deletions often do not develop pheochromocytomas, while families who have point mutations are more likely to present with pheochromocytomas. This is why it’s important to know what mutation one has, because one can then pay more attention to certain types of screening and tests.

– Myriam Gorospe, Ph.D., Director of Research, VHLFA

As printed in the VHL Family Forum 10:2, June 2002. For permission to reprint, please contact VHL Family Alliance, editor@vhl.org.